SHARE THIS SHOW:
RELATED CONVERSATIONS:
RECENTLY ON TOL:
TOL Our Town
- A tumblr site dedicated to the people and places that make up Oregon and Southwest Washington.
TAGS:
Genetic testing used to be the purview of highly specialized doctors. Now, a host of startup companies are selling at-home kits that promise to unlock the secrets of customers' DNA in a matter of weeks. Intel employees, who get a discounts from two genetic testing companies, use the tests to reveal their genetic predisposition to everything from cancer to cellulite. But many in the medical community are skeptical of the tests' legitimacy, and the U.S. Government Accountability Office recently released a report calling the tests "misleading" and accusing the companies administering them of "questionable practices."
Have you elected to use genetic testing? If so, why? What was your experience?
Special thanks to stalwart TOL commenter rethomas, who suggested this show to us two weeks ago.
Tagged as: economy · genetics · health · medicine
Photo credit: Mr. Happy / Creative Commons
-
With some types of cancer and heart disease that seem to run in one or another sides of my family tree, I'd simply be interested in finding out if there's something worthwhile to commercially available tests or if all I'm likely to get is the scientific equivalent of my horoscope...
-
Though genetics is an advanced science, it is also common sense. If the father and mother are obese, the odds are the child will also be overweight. IF everyone in your family had a heart attack before they were 60 yo, chances are pretty good for you too.
You can make a personal family tree of diseases, age of death and cause of death that can be very insightful and it will not cost you a dollar. But this involves a painful manuever; TALKING with your relatives--including the dysfunctional relations. People want to take a pill or have a passive path to answers.
Though we have sequenced the Human Genome, we still do not know how most proteins, hormonal agents and diseases play out in the organism. And a test would only look at one narrow coding of DNA. Looking at one tiny portion, is trying to judge a Jigsaw Puzzle based on a single piece.
Your best bet for good health and longevity is simple common sense that EVERYBODY KNOWS, but few act on: This is vetted by the Harvard Framingham Longitudinal Heart Study:
Exercise Daily equivalent to walking 1 hour per day.
Maintain a normal body weight.
Quit Smoking.
Stay away from Alcohol if you think you may be Alcoholic.
Watch your Cholesterol and Hypertension.
Wash Your Hands.
Get enough Sleep.
Wear a Seatbelt.
Brush Your Teeth and maintain Good Dental Hygiene.
Be in a Stable Marriage.
Get a Mammogram and Regular Checkups.
....Don't worry about testing your DNA, Chromium levels or Bio-rhythms; They are Fortune Cookies for your amusement.
-
What really is the purpose of having one's DNA tested? It isn't as though you can really change it once the ovum is fertilized, and should the troublemakers working in the insurance industry hear of your test results, one might find that they can't get health insurance because they inherited a breast cancer gene, or life insurance due to a congenital fault in their pancreas or something.
No, I would not waste my money on genetic testing to determine whether I might or might not have the BRCA-1 or -2 gene. That is why we (women) get mammograms and other clinical screening procedures. (True, mammograms won't be so useful for male patients, who CAN get breast cancer, no matter how hard they try to deny the potential...the Komen organization published statistics in a recent year that showed that 1 of every 92 patients diagnosed were MALE.)
-
Would you like your genetic code divulged to the world? What the preview to the show does not indicate tonight, I would like to write or call in tomorrow morning at 9AM and ask; as I have heard that the government is compiling a new program that everyone in the world will be required to have their DNA code displayed on the web one day soon. This program has already started- Guess where it will be? It’s currently called Facebook and it will be more than an elective social networking site that we currently think of it as just for fun. Charlie Rose interviewed the woman a couple years back that is leading this new requirement for the government. Don’t laugh or wince as she did in the interview as she says her DNA is already displayed- I cannot remember her name now or even find the search info, but she said she has no fear of showing her DNA to the world as it has no defects. This won’t hurt a bit as the doctors used to say but just imagine the uses of this for everyone else with defective DNA; it will now show if you are diabetic, alcoholic, schizophrenic, your crime tendencies, everything about your personal life will become the scrutinizing of future Health Insurance Companies, employers, etc. You might be rejected in belonging to some club or benefit or employment for your less than perfect DNA. Welcome to the “New World Order.” Will you take the red pill or the blue pill? You may have no choice in our near future.
-
As autism runs higher in left handed people who also show higher IQ and creative capacity [I am a retired left handed awarded artist and astronomy educator, as all of the greatest artists-musians in history, scientists, most prominent leaders of the world are mostly left handed people] I'd love to see my DNA. See this report just off the BBC World News moment ago >
http://www.upi.com/Science_News/2010/08/10/New-brain-scan-test-for-adult-autism/UPI-35891281484423/
-
There are misconceptions about DNA. People think that it is a Menu with several courses and a desert clearly indicated with prices. In one microcopic skin cell at the base of an eyelash, there are 3 BILLION precisely coded base pairs. 90% of it is garbage DNA, or non coding for proteins. And most of the time we don't know treasure from garbage. And if you were to put it 'on the internet' it would read: AAATTCGCCTTATCGCGCATTTATATACGCGGGG ......for code longer than Windows 7.
I don't know how the public would treat such of document of indecipherable nonsense that would fill most hard drives to capacity. It isn't a menu.
The hard part in genetics is deciphering the code for significance Some proteins are scrambled over wide skip sections. Some only are translated in specific cells or in certain times of development .ie embryo stage. Some can be asleep for decades before activation. IT is like looking at the engineering manual for a 747 Jet Plane written in Egyptian Hieroglyphics and scrambled by the Enigma Encryption device.
I don't think we have a single identified gene specific to LEFT handedness, creative artists or even Manic Disorder. A lot of these are interplay between genes, enviorment and epigenetic factors--but we don't know the recipe.
-
One of my friends got two different DNA test kits to test her mutt dog. The test promised to tell you which breeds your dog is. The test results came back and of the two tests, each had different-- and mutually exclusive--results. My friend was planning a "who's your daddy" party for her dog and make it a game to guess the dog's background. However, with the results so inconclusive, she had to nix the theme of the party.
-
A NYT article earlier this year called these tests great for "recreation", but "very premature" for healthcare, with the current level of testing "unable to offer meaningful predictions about the risk that a person will get a disease."
http://www.nytimes.com/2010/03/20/business/20consumergene.html
-
Based on the results of a routine lab test, I was tested genetically.
The nice thing is that if I do not die of laughter observing the left and the right schism in today’s society; unlike most of you I know what is going to kill me!
That and my children and theirs can get well ahead of the genetic disposition, and live longer then I shall.
Laughter the best the best medicine!
It also remains free! -
I'm an MD Clinical Geneticist, a specific, AMA-recognized, board-certified medical specialty. I'm weighing in here to give some educated, authoritative information, just in case anyone wants that. Of the 10 comments so far added to this discussion, not one has the facts right. I was recently shown a doctor’s blog site where the level of misunderstanding displayed in the comments by doctors was just as alarming. Today, I want to make several important points:
1. Legitimate genetic testing is extremely useful when it provides you with a) actionable, specific information about your illness or that of a relative which you may also be liable to, b) a clear understanding of the root causes of your medical condition, even if there is no disease-specific recourse available at this time. Genetic testing that provides you with vague, imprecise, inaccurate, or over-interpreted information about your future risks is, in my opinion, of very limited value, and may, in some circumstances do harm.
2. Legitimate genetic testing is often excluded from your health insurance coverage, or severely restricted requiring lots of hoop-jumping and appeals of ill-informed coverage denials. Some very large insurance companies have blanket policies that limits your access to tests that may be valuable to you, unless you're willing and able to pay out of pocket for them. In my view, legitimate genetic tests are treated differently by the 3rd-party-payer industry than "mainstream" tests, even though they have, in the right hands, just as much potential to inform the healthcare process. The "direct-to-consumer" tests, being on the average much less medically useful, and the lack of clear distinction between them and medically indicated genetic tests, I believe make the insurers shy further away from even legitimate testing.
3. Don't confuse "direct to consumer" with "not all that useful" or vice versa. At present, there is significant overlap between those groups, but that's the result of market forces and some FDA oversight of the useful sort, not because the mode of marketing a product is an inevitable indicator of its usefulness.
(continued next post)
-
(continued from previous post)
4. The trained professionals who are most in a position to help you understand the complexities and nuances of genetic testing, and the massive advances in technology and very useful information just around the corner, are Board-certified Clinical Geneticists and Board-certified Genetic Counselors. They often work as a team. Unfortunately, they/we are, in my experience, the proverbial stepchildren of medical insurance/reimbursement system. These highly trained professionals cannot bill the system sufficiently (in the case of Genetic Counselors, not at all) to even break even. They must be subsidized as a loss-leader to whatever system thy operate in. That's why there are so few of us in existence, and why you never see us in independent private practice, the model that remains the "ideal" of American medical hegemony. Ironically, as our society enters yet another period of expanded need for professional genetics information in our daily lives, the number of new Clinical Geneticists graduating is dropping, and the number who drop out of practice to do something that can be gainfully remunerated is increasing, particularly, but not exclusively, outside of the medical school setting.
5. There are too few of us in the Medical Genetics community to get the system changed for the better, and many of us are restricted in our advocacy roles by our professional affiliations and receipt of limited government funds subsidizing our patient work. The patients and others who stand to benefit from advances in genetic technology and knowledge are the ones who will have to advocate for change. At present, that population, as evidenced by the comments here and even those on physicians' groups blog comments, doesn't even know enough to begin, let alone understand how to define itself. I don't know what the solution is, but I do know that Americans need to decide if they want to move forward accurately informed about Genetics, or just perpetuate myths and ignorance. If the former, they need to advocate for the professionals who can make it happen.
6. Thanks to OPB and Dave Miller for getting the discussion going!
-
I want to expressmoncler my admiration of your writing skill and ability to makemoncler jackets reader to read the while thing to the end.moncler jacket I would like to read more of your blogs and to share my thoughts with you. I will be your frequent visitor, that’s for sure. moncler coats
-
Comments are now closed.
I do hope that at least one person who contributes to this upcoming show on genetics will be familiar with the work of Bruce Lipton, author of "Biology of Belief," and "Spontaneous Evolution," or the film The Living Matrix. That way your listeners will have a better opportunity to be informed of the latest, most cutting-edge thinking on the subject of epigenetics -- or science that goes deeper and beyond the study of genes.
From Spontaneous Evolution p. 136: Despite the failure of the Human Genome Project to find 100,000 genes and the discovery that genes are not self emergent, the public continues to believe in genetic determinism.
p. 16: Evolving new-edge science reveals that our power to control our lives originates from our minds and is not preprogrammed in our genes.
In the film, The Living Matrix, scientists, psychologists, bioenergetic researchers and holistic practitioners offer new perspectives on the subject.